ISSN: 2332-0877
Journal of Infectious Diseases & Therapy
Make the best use of Scientific Research and information from our 700+ peer reviewed, Open Access Journals that operates with the help of 50,000+ Editorial Board Members and esteemed reviewers and 1000+ Scientific associations in Medical, Clinical, Pharmaceutical, Engineering, Technology and Management Fields.
Meet Inspiring Speakers and Experts at our 3000+ Global Conferenceseries Events with over 600+ Conferences, 1200+ Symposiums and 1200+ Workshops on Medical, Pharma, Engineering, Science, Technology and Business

Risk Factors Associated with Helicobacter Pylori Infections in Makurdi Northcentral Nigeria

Mnena EY1*, Ebele U1 and Emmanuel N2

1Department of Biological Sciences, Federal University of Agriculture, Makurdi, Benue State, Nigeria

2Safety Molecular Pathology Laboratory, Plot 44 Rangers Avenue, Independence Layout Enugu, Nigeria

*Corresponding Author:
Yaji Mnena E
Department of Biological Sciences
Federal University of Agriculture
Makurdi, Benue State, Nigeria
Tel: 07030695000
E-mail: Yajimnena@gmail.com

Received date: May 30, 2017; Accepted date: July 18, 2017; Published date: July 24, 2017

Citation: Mnena EY, Ebele U, Emmanuel N (2017) Risk Factors Associated with Helicobacter Pylori Infections in Makurdi Northcentral Nigeria. J Infect Dis Ther 5:325. doi: 10.4172/2332-0877.1000325

Copyright: © 2017 Mnena EY, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Visit for more related articles at Journal of Infectious Diseases & Therapy

Abstract

Background: Helicobacter Pylori (H. pylori) is a microaerophilic bacterium that inhabits the gastric mucosa of the human stomach. Infection with this bacterium leads to chronic gastritis, peptic ulceration, gastric cancers and gastric malt lymphoma. Studies have documented a higher prevalence in Africa and the transmission pathways are still vaque.

Methods: Eighty gastric biopsies were collected from the antrum of patients referred for endoscopy. Informed consent was obtained and questionnaires on risk factors such as type of water used, foods and habitswere administered to them. Genomic DNA was extracted from the tissue samples using ReliaPrep genomic DNA miniprep kit (Promega, Southampton UK), and H. pylori DNA was detected using a Singleplex PCR of the 16S rRNA gene.

Results: Of all the parameters analyzed, only involvement in milking of cows (OR=3.545, 95% CI: 2.488-5.052; p=0.029) and sharing of spoons and cups (OR=45.00, 95% CI: 8.769-230.936; p <0.001) had significant association with transmission, and patients were at increased risk of infection.

Conclusion: Transmission of H. pylori may be associated with the risk factors related to hygiene. Adequate hygiene is advocated to reduce the scourge of the infection.

Keywords

Risk factors, Helicobacter Pylori infection, Transmission

Introduction

Helicobacter Pylori are a Gram negative miroaerophic spiral bacterium which was discovered in 1983 [1]. It infects more than half of the world’s population with prevalence ranging from 25% in developed countries to more than 90% in developing countries [2]. The increased risk of infection is especially high among those living in the developing world [3]. Infection with the bacterium causes chronic gastritis, peptic ulceration, gastric cancers and gastric Mucosa Associated Lymphoid Tissue (MALT) Lymphoma [3]. Helicobacter Pylori have been rated as a “class one” carcinogen to the gastrointestinal tract by the World Health Organization [4]. It is in the same category as cigarette smoke is to lung cancer.

H. pylori prevalence and the rate of infection are inversely related to the standardof living and sanitary practice as revealed by a very high prevalence, especially in developing countries and lower socio-economic groups in the developed world [2,3,5]. The transmission pathways of H. pylori are still not clear. However, risk factors of transmission include precarious hygiene standards, over-crowding, contaminated environments and water sources amongst others [6]. Oral-oral, Feacal-oral, and direct contact modes have been proposed as possible modes of transmission, either with or without transitional transmission steps during episodes of diarrhea or gastro-oral contact in the event of vomiting [6]. It has been found that H. pylori can live in milk and water in its infectious bacillary form and inriver water for several months in a non-culturable but viable form [7]. Previous serological studies have related a high prevalence of antibodies against H. pylori among someprofessions (Abattoir workers, shepherds and veterinary workers) who are in direct contact with H. pylori infected animals [8]. H. pylori have also been isolated from the intestinal tract of dogs, cats and sheep [9].

H. pylori are believed to be transmitted primarily by faecal- oral and oral-oral routes, with water and food as possible vehicles of infection. However, exact modes of transmission are not easily determined because H. pylori are difficult to culture from environmental samples. There is some evidence for iatrogenic transmission through inadequately sterilizedendoscopes. H. pylori have been detected in vomitus, indicating the potential for gastro-oral transmission [10].

The burden of H. pylori infection is so much that the infected individuals live the rest of their lives taking drugs, avoiding certain foods and drinks because they believe it has no cure [11]. Although extensive research has been carried out on H. pylori , the data from Nigeria has tended to focus on its prevalence and very little on risk factors associated with H. pylori infection.

Our study was aimed at determining the association of risk factors with H. pylori infection in the study area. The specific objectives were to detect H. pylori from biopsies by PCR and to determine the relationship between H. pylori prevalence and risk factors in the study area.

Materials and Methods

Ethical approval

Ethical approval was obtained from the Health Research Ethics Committee of the Benue State University Teaching Hospital, Makurdi. All participants had medical referrals for gastric biopsy at the Department of Gastroenterology of the Benue State University Teaching Hospital, Makurdi. Volunteered participants were informed-consented with written consent. Subjects were patients who had various H. pylori associated dyspeptic symptoms including epigastric pain, fullness, vomiting, nausea and flatulence.

Sample size determination

Sample size was calculated using Raosoft (2014) Sample Size Calculator. At 0.05 alpha level of significance, 95% confidence level and a patient population size of 99 and previous prevalence 50%, a sample size of 80 was obtained.

Questionnaires

Validated Questionnaire containing questions on the risk factors associated with H. pylori infection was administered to volunteered participants.

Sample collection

A Consultant Gastroenterologist performed the endoscopy on informed- consented participants. Gastric biopsy samples were taken from the antrum of the patients into sterile McCartney bottles containing Brain Heart infusion broth and stored in the freezer at -200 C within 2 h of collection until transported to the Laboratory for analysis.

Extraction of genomic DNA

Genomic DNA was extracted from the tissue samples using ReliaPrep genomic DNA miniprep kit (Promega, Southampton UK). The Reliaprep uses spin columns that contain silica membrane for DNA purification. Briefly, about 200 μl of the macerated tissue materials in broth were dispensed into 2 ml Eppendorf tube containing 25 μl of proteinase K. The sample was mixed by gentle vortex and incubated for 5 min at room temperature. Then 200 μl of Cell Lysis Buffer was added and the sample vortexed for 10 seconds before incubation in a water bath set at 560ºC for 10 min. Thereafter, 250 μl of Binding Buffer was added to the sample and mixed by repeated pipetting. The mixture was transferred to the Spin Column and centrifuged at 14000 rpm for one minute. The flow through in the collection tube was discarded. The column was washed by addition of 500 μl of Column Wash Buffer and centrifuged for 3 min at 14000 rpm. The washing was repeated twice. Columns were then placed into new Collection tubes and centrifuged at 14000 rpm for 1 min to remove residual Wash Buffer. Then 100 μl of Nuclease-free water was added into the columns, which were placed into 1.5 ml tubes, incubated for one minute at room temperature and centrifuged at 13000 rpm for one minute. DNA quality was checked by reading at 260/280 nm using Eppendorf Biophotometer Plus (Eppendorf, Germany). The DNA elute was labeled and stored in the fridge until required for testing.

Specific primers for detection of H. pylori

The primer sequences used were: 16S rRNA - F=GGAGGATGAAGGTTTTAGGATTG (23), 16S rRNA - R=TCGTTTAGGGCGTGGACT (18) (synthesized by Eurofins, Germany).

Detection of H. pylori 16S rRNA gene

H. pylori DNA was detected by using a Singleplex PCR that amplifies 294 bp fragment using a final primer concentration of 0.5 μM in a 25 μl reaction volume. The thermal profile comprised initial denaturation at 95ºC for 3 min, followed by 35 cycles of 94ºC for 30s, 70ºC for 60s and 72ºC for 60s and a final extension of 72ºC for 5 min. All amplifications were carried out in Eppendorf Nexus Gradient Master Cycler (Eppendorf, Germany) using 2x PCR Master Mix from Promega (Southampton, UK). PCR products were electrophoresed at 100 V for 30 min using 1.5% agarose gel stained with Ethidium bromide.

Statistical Analysis

Data were analysed using Statistical Package for Social Sciences (SPSS) version 20, IBM Inc. Chi square was used to measure association; Odds Ratio OR was used to assess risk factors. Alpha level of significance was set at 0.05.

Results

Of the 80 biopsies collected, 30 cases with gastritis, 22 (73%) had H. pylori while 2 (4%) out of the 50 cases with normal mucosa had H. pylori . There was significantly increased risk of H. pylori infection in gastritis patients (Table 1). There was no significant association between the sources of water used and H. pylori infection in patients (Table 2). In Table 3, drinking of unpasteurized milk was associated with transmission of infection, which means those drinking unpasteurized milks are at increased risk of infection; drinking of alcohol had no significant association with transmission, eating of raw vegetables also had no significant association with transmission of the infection.

Case Group Positive (%) Negative (%) Total (%) Odds
Ratio
95% Confidence Interval X2 value p-value
Abnormal Mucosa (gastritis) 22 (73) 8 (27) 30 (100) 66.00 12.937-336.717 42.92 <0.001
Normal Mucosa 2 (4) 48 (96) 50 (100)        

Table 1: Helicobacter pylori Detected in Biopsies of Patients by PCR (n=80).

Sources of water Number (%) Number Positive (%) Number Negative (%)
Well 24 (30) 8 (33.3) 16 (66.7)
Stream 9 (11.25) 4 (44.4) 5 (55.6)
Pipe borne 24 (30) 7 (29.2) 17 (70.8)
Bore hole 22 (27.5) 4 (18.2) 18 (81.8)
Rain water 1 (1.25) 1 (100) 0 (0)
Total 80 (100) 24 56
χ2=1.50, df=4, p=0.68

Table 2: Distribution of Helicobacter pylori as Influenced by Sources of Water used by Patients in the Study.

Variables Number (%) Positive (%) Negative (%) Odds Ratio 95% Confidence Interval X2 value p-value
Drinking of unpasteurized milk
Yes 76 (95) 21 (27.6) 55 (72.4)        
No 4 (5) 3 (75) 1 (25) 0.127 0.013-1.293 4.06 0.044
Total 80 (100) 24 56        
Drinking of alcohol
Yes 50 (62.5) 15 (30) 35 (70)        
No 30 (37.5) 9 (30) 21 (70) 1.076 0.254-2.176 0 0.1
Total 80 (100) 24 56        
Eating of raw vegetables
Yes 59 (73.75) 18 (30.5) 41 (69.5)        
No 21 (26.25) 6 (28.6) 15 (71.4) 1.098 0.366-3.287 0.028 0.868
Total 80 (100) 24 56        

Table 3: Distribution of Helicobacter pylori as influenced by foods that are risk factors.

Of all the habits analysed, only involvement in milking of cows and sharing of spoons and cups had significant association with transmission, and patients were at increased risk of infection, the rest had no association (Table 4).

Habit Response number (%) Positive (%) Negative (%) Odds Ratio Confidence Interval 95% X2 value P-value
Keeping of domestic animals
Yes 70 (87.75) 21 (30) 49 (70)        
No 10 (12.25) 3 (30) 7 (70) 1 0.236-4.246 0 0.1
Total 80 (100) 24 56        
Washing of hands after defecation
Yes 79 (98.75) 24 (30.4) 55 (69.6)        
No 1 (1.25) 0 (0) 1 (100) 0.696 0.602-0.805 0.43 0.51
Total 80 (100) 24 56        
Keeping of long nails
Yes 19 (23.75) 5 (26.3) 14 (73.7)        
No 61 (76.25) 19 (31.1) 42 (68.9) 0.789 0.248-2.508 0.16 0.69
Total 80 (100) 24 56        
Involvement in milking of cow
Yes 2 (2.5) 2 (100) 0 (0)        
No 78 (97.5) 22 (28.2) 56 (71.8) 3.545 2.488-5.052 4.79 0.029
Total 80 (100) 24 56        
Sharing of spoons and cups
Yes 17 (21.25) 15 (88.2) 2 (11.8)        
No 63 (78.75) 9 (14.3) 54 (85.7) 45 8.769-230.936 34.86 <0.001
Total 80 (100) 24 56        
Sharing of bedroom
Yes 72 (90) 22 (30.6) 50 (69.4)        
No 8 (10) 2 (25) 6 (75) 1.32 0.247-7.061 0.1 0.75
Total 80 (100) 24 56        
Sucking of thumb in childhood
Yes 20 (25) 6 (30) 14 (70)        
No 60 (75) 18 (30) 42 (70) 1 0.331-3.017 0 0.1
Total 80 (100) 24 56        
Sharing of tooth brush
Yes 2 (2.5) 1 (50) 1 (50)        
No 78 (97.5) 23 (29.5) 55 (70.5) 2.391 0.143-39.887 0.39 0.53
Total 80 (100) 24 56        
               
Washing of fruits before eating
Yes 78 (97.5) 23 (29.5) 55 (70.5)        
No 2 (2.5) 1 (50) 1 (50) 0.418 0.025-6.975 0.39 0.53
Total 80 (100) 24 56    

Table 4: Distribution of Helicobacter pylori as Influenced by Habits that are Risk Factors.

Discussion

The distribution of H. pylori as influenced by sources of water used in our study did not show any significant association between the sources of water used and H. pylori infection in patients (Table 2). This was not the case in Kazakhstan, where drinking river water had the highest risk of H. pylori infection (OR: 13.6, 95% CI=1.8–102.4; p<0.01), compared with tap water [12]. In South India, Almed et al. reported that H. pylori was higher in people with low clean water index (CWI) (88,2%) than those with higher CWI (33.3) [3]. Also, Ndip et al. reported that the very high prevalence of H. pylori in Africa might be linked to water sources [13]. Several other studies had highlighted the presence of the microorganism or their DNA in water [7,14-16]. The findings of this study did not also agree with the study by Papiez et al. that water-borne transmission of H. pylori could be an important source of infection in developing countries [8]. A study in Guatemala reported that H. pylori was unlikely to be transmitted by water [17] but epidemiological studies in many countries such as China [18], Lima Peru [19], and Colombia [20] had shown that infection was related to H. pylori contaminated water sources. Dube et al. also reported that H. pylori could live in tap water in its infectious bacillary form, and in river water for several months in the nonculturable but viable cocoid form. According to Sorbey et al., faecally contaminated water had the potential for transmission via the faecaloral route [21]. Faults in pipelines near or across a drainage system were found to be strongly correlated with high level of contamination of pipe-borne water supplies in Lagos, Nigeria. Goodman et al. and Steinberg et al. reported in the US that the presence of H. pylori in untreated well correlated with infection in consumers [22,23]. In Japan, H. pylori DNA was detected in well water used by persons who had acquired H. pylori infection in the past [24]. In continuation, Eguari and Aboaba detected H. pylori DNA in well water obtained from all five wells from which five seropositive members had drunk [25]. Ahmed et al. in South India also reported that the prevalence of H. pylori infection among people who drank well water was 92% compared with 74.8% of those who drank tap water (p<0.001) [3]. Several Epidemiological studies in many countries such as rural China, Lima Peru and Colombia had also shown that infection was related to H. pylori contaminated water sources [18-20]. However, in agreement with our study, Klein et al. reported in a study in Guatemala that H. pylori were unlikely to be transmitted by water [17].

Involvement in milking of cows had significant association with transmission of the infection (Table 4). This agreed with the report of Papiez et al. who showed a higher prevalence of antibodies against H. pylori among some professions (Abattoir workers, Shepherds and Veterinarians) probably due to direct contact with H. pylori infected animals [8]. Papiez reported that milking appears to be a possible means of transmission. Bragonca et al. found that H. pylori could live in milk in its infectious bacillary for several months in a non-culturable but viable form [7]. It has also been reported that H. pylori could live for several days in milk in its infectious bacillary form [5].

Sharing of spoons and cups had a significant association with transmission of H. pylori infection in our study as indicated in Table 4. Sharing of spoons, cups, premastication for young children, sharing water for bathing and washing hands and limited sanitary facilities have also been shown to be associated with increased prevalence of the organism [3,13].

In this study, there was no association between H. pylori and sharing of bedrooms (Table 4). This did not agree with the findings of Farrel et al. who reported that sharing a bed or bedroom with an infected sibling at the age of 3 significantly increased the risk of childhood H. pylori infection [26].

In Table 3, drinking of alcohol was not associated with H. pylori infection in our study. This agreed with the findings of Mckeown et al. who reported that antibody status did not differ with respect to alcohol [18]. This did not however agree with the findings of Zhang et al. who reported an association between the two in Australia. They found that alcohol consumption and pathology active gastritis were associated with H. pylori infection. Active gastritis was associated with alcohol consumption. They therefore concluded that alcohol consumption was associated with H. pylori infection [27]. Ogihara et al. also reported that drinkers had a 0.88 (0.74-0.91) fold greater risk of H. pylori seropositivity than those who had never taken alcohol [28]. However, Brenner et al. reported that alcohol had strong antimicrobial activity and stimulates gastric acid secretion and might therefore compromise living conditions of H. pylori in the stomach. They assessed the relationship of alcohol consumption with H. pylori infection among 1,785 participants aged 18-88 years in the German National Health and Nutrition Survey. There was a clear, intense dose-response relation between reported alcohol consumption and H. pylori infection. The adjusted prevalence ratios (95% confidence intervals) for H. pylori infection among persons who consumed up to 10, 10-20, and more than 20 gm of alcohol per day compared with non-drinkers were 0.93 (0.77-1.13), 0.82 (0.65-1.04), and 0.71 (0.55-0.92) [29]. These findings supported the hypothesis that moderate alcohol consumption might facilitate spontaneous elimination of H. pylori infection among adults.

Several studies have shown a possibility of transmission pathway through domestic cats, dogs and sheep [8]. However, this study did not find any association between keeping of domestic animals and H. pylori infection (Table 4). The findings were in concordance with the findings of Webb, who reported in the United Kingdom that there was no association between H. pylori seropositivity and cat ownership during childhood [30]. In Southern Germany, in 1966-1997 among children in first grade, neither contact with specific kinds of animals was positively associated with H. pylori infection [31].

Washing of hands after defecation was not associated with H. pylori infection in the present study as seen in Table 4, but in China, prevalence was elevated due to infrequent hand washing before meals. Washing less than half of the time (OR=1.6, 95% CI: 1.0-2.5; % of seropositivity=74.4%), and never washing (OR=3.8, 95% CI: 1.5-31.0; % seropositivity=87.5% [32].

Conclusion

H. pylori infection in the study was found not to be associated with sources of water used, drinking of alcohol, eating of raw vegetables, keeping of domestic animals, keeping of long nails, sharing of bedroom, sharing of tooth brush and sucking of thumb in childhood rather associated with sharing of cups and spoons and involvement in milking of cows.

Acknowledgements

The research was carried out in Safety Molecular Pathology Laboratory Enugu (www.safetymolecularpath.org), supported in part by a research grant from the Federal University of Agriculture Makurdi, Benue, Nigeria. We also thank the Benue State University Teaching Hospital Makurdi, Nigeria for providing the gastric biopsy specimens and all the patients who volunteered to be used.

Conflicts of Interest

Authors declared no conflicts of interest.

References

--
Post your comment

Share This Article

Article Usage

  • Total views: 5343
  • [From(publication date):
    August-2017 - May 14, 2025]
  • Breakdown by view type
  • HTML page views : 4421
  • PDF downloads : 922
Top