alexa Absence of Anaplasmataceae DNA in Wild Birds and Bats from a Flooded Area in the Brazilian Northern Pantanal | OMICS International
ISSN: 2167-7719
Air & Water Borne Diseases
Make the best use of Scientific Research and information from our 700+ peer reviewed, Open Access Journals that operates with the help of 50,000+ Editorial Board Members and esteemed reviewers and 1000+ Scientific associations in Medical, Clinical, Pharmaceutical, Engineering, Technology and Management Fields.
Meet Inspiring Speakers and Experts at our 3000+ Global Conferenceseries Events with over 600+ Conferences, 1200+ Symposiums and 1200+ Workshops on
Medical, Pharma, Engineering, Science, Technology and Business

Absence of Anaplasmataceae DNA in Wild Birds and Bats from a Flooded Area in the Brazilian Northern Pantanal

Luana Gabriela Ferreira dos Santos1, Tatiana Ometto2, Jansen de Araújo2, Luciano Matsumya Thomazelli2, Leticia Pinto Borges1, Dirceu Guilherme Ramos3, Edison Luis Durigon2, Joao Batista Pinho4 and Daniel Moura de Aguiar1*

1Laboratorio de Virologia e Rickettsioses, Hospital Veterinario, Universidade Federal de Mato Grosso, Brazil

2Laboratorio de Virologia Clinica e Molecular NB3+, Departamento de Microbiologia, Instituto de Ciencias Biomedicas II, Universidade de Sao Paulo, Brazil

3Laboratorio de Parasitologia e Doencas Parasitarias, Hospital Veterinario, Universidade Federal de Mato Grosso, Brazil

4Laboratório de Ecologia de Aves, Instituto de Biociências, Universidade Federal de Mato Grosso, Brazil

*Corresponding Author:
Daniel Moura de Aguiar
Laboratorio de Virologia e Rickettsioses, Hospital Veterinario
Universidade Federal de Mato Grosso. Av. Fernando Correa
2367, Boa Esperanca, Cuiaba, Brazil
Tel: +55 65 36158627
E-mail: [email protected]

Received Date: August 06, 2013; Accepted Date: September 02, 2013; Published Date: September 09, 2013

Citation: dos Santos LGF, Ometto T, de Araújo J, Thomazelli LM, Borges LP (2013) Absence of Anaplasmataceae DNA in Wild Birds and Bats from a Flooded Area in the Brazilian Northern Pantanal. Air Water Borne Diseases 2:113. doi:10.4172/2167-7719.1000113

Copyright: © 2013 dos Santos LGF, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Visit for more related articles at Air & Water Borne Diseases

Abstract

Birds and bats can be considered potential transmitters of some tick-borne diseases, since eventually they carry infected ticks in areas where transit. Pantanal ecosystem is the largest tropical wetland area of the world with more than 582 recorded avian species, contributing to the maintenance of different tick species. The aim of this study was to examine altogether 152 blood samples of several bird and bat species collected in a large flooded area of Pantanal for the presence of members from genera Ehrlichia, Anaplasma and Neorickettsia. None PCR product was obtained, what suggest that wild, domestic birds and bats from Pantanal region are unlikely to play a significant role in the maintenance of tick-borne agents and DNA survey from this species in birds may not be a reliable indicator of exposure.

Keywords

Tick-borne disease; Anaplasmataceae; Fowl; Poconé; Brazil

Introduction

Birds and bats can act as reservoirs of several pathogens including those transmitted by ticks and flies. Some infections can be transmitted by trematode-vectors, which use freshwater snails and aquatic insects as intermediate hosts and insectivorous birds and bats as definitive hosts. They also can be considered as potential transmitters of some tickborne diseases, mainly due to its migratory character, since eventually they carry the infected ticks in areas where transit. Agents that stand out are the bacteria from Anaplasmataceaes family that already have been widely associated with disease in humans and animals, with cycle involving invertebrate vectors. Pathogens such as Ehrlichia, Anaplasma and Neorickettsia are being increasingly recognized around the world in order to elucidate the importance of its infections and ability to cause illness in animals and/or human beings [1-4].

Anaplasmataceae agents comprise obligate intracellular bacteria that can cause disease in humans and animals, whose cycle in the environment involves complex interactions between invertebrate vectors and vertebrate hosts [5]. There is ecological evidence that passerine birds, at least in principle, could be competent reservoirs for A. phagocytophilum as many avian species host larval and nymphal I. scapularis ticks [6,7]. Exposure of passerines to A. phagocytophilum-infected nymphs has been demonstrated [8], including infected larvae found attached to an American robin (Turdus migratorius) and a veery (Catharus fuscescens) [9]. However, direct evidence demonstrating birds as competent reservoirs of members from the family Anaplasmataceae are still scarce.

For instance in Brazil, Machado et al. [1] was the only one that reported molecular detection of A. phagocytophilum in carnivorous and migratory birds. Additionally they also reported for the first time DNA of E. chaffeensis and an Ehrlichia species, phylogenetically related to E. canis in birds sampled in Mato Grosso and Sao Paulo state.

Neorickettsia risticii (formerly Ehrlichia risticii) belongs to the Anaplasmataceae family and is the causative agent of Potomac Horse Fever (also known as Equine Monocytic Ehrlichiosis- EME), a severe febrile disease affecting horses, typically found in endemic countries during the warmest months. In the environment, N. risticii infects trematodes from the genus Acanthatrium and Lecithodendrium. The lifecycles of these trematodes are not very clear, both are known to involve several stages that range from free-living cercaria to forms that infect invertebrates such as the miracidia and sporocysts (that infect freshwater snails) and the metacercaria (that infect aquatic insects) [10].

In enzootic areas of USA, a common pleurocerid snail, Juga yrekaensis is suspected to be involved in the life cycle of N. risticii [11]. Additionally, DNA from N. risticii has been detected in virgulate cercariae in lymnaeid snails (Stagnicola spp.) in virgulate xiphidiocercariae isolated from pleurocerid snails Elimia livescens and Elimia virginica, indicating that other species of freshwater snails may also harbor infected trematodes [12,13]. Adult forms of these trematodes develop in the intestine of insectivorous vertebrates such as bats and birds, therefore it has been suggested that certain species of bats and birds (swallows) may act as wild reservoirs of N. risticii [14,15]. Recently, molecular detection of N. risticii in bats of the species Tadarida brasiliensis was reported in Argentina [16].

In Brazil, spontaneous outbreaks of equine monocytic Ehrlichiosis (EME) were described in south region [17-19]. In Rio Grande do Sul state, snails from the genus Heleobia, harboring Parapleurolophocercous cercarie, have been identified as carriers of N. risticii [18]. Three species are extremely abundant both in permanent streams and small rivers and on temporarily flooded areas of the Pantanal, namely Marisa planogyra, Pomacea linearis and Pomacea scalaris [20]. Apple snails Pomacea lineata are widespread in the tropical regions of Brazil as well as in the Pantanal wetland of Mato Grosso in the western part of the country. This species serve as food for many animals, mainly birds, fishes and caimans [21].

The Pantanal ecosystem is the largest tropical wetland area of the world, situated among two Brazilian states (Mato Grosso and Mato Grosso do Sul) and in portions of Bolivia and Paraguay. The Pantanal is characterized by an immense diversity, where more than 80 species of mammals [22] and 582 avian species, contributing to the maintenance of different tick species have already been recorded [23-25]. Furthermore the aquatic environment can favor the establishment of different species of trematodes, metacercarias and snails which jointly with birds and bats support the occurrence of N. risticii in the area. Nevertheless, the role of birds and bats in the epidemiology of tick- and water-borne diseases has been poorly studied, and the connection between birds, dispersal of infected ticks, rickettsial agents and zoonosis outbreaks need to be clarified. The aim of this study was to evaluate blood samples of several birds and bats species collected in the northern Brazilian Pantanal for the presence of members from genera Ehrlichia, Anaplasma and Neorickettsia.

Materials and Methods

Samples of whole blood stored in cryopreserved bank were evaluated. Blood samples were collected in the Pocone municipality at the locality called Pirizal (16°15’12’’S 56°22’12’’W; Figure 1) during November 2012, totaling 152 samples from domestic and wild birds and bats. Regarding tick infestation, no information was obtained from the samples studied. Blood samples were subjected to DNA extraction protocol [26] using guanidine thiocyanate and DNA samples were tested individually for detection of Ehrlichia spp., Anaplasma spp. and N. risticii, according to the protocols described in Table 1.

air-water-borne-diseases-collection

Figure 1: Collection points at Poconé municipality, Pirizal region. November 2012.

Pathogen Primer* Sequence(5’ - 3’) References
Ehrlichia spp. dsb 330 (1s)
dsb 720 (1sand2nd)
dsb 380 (2nd)
GATGATGTTTGAAGATATSAAACAAAT
CTATTTTACTTCTTAAAGTTGATAWATC
ATTTTTAGRGATTTTCCAATACTTGG
[38]
Anaplasma spp gE3a (1s)
gE10R (1s)
gE2 (2nd)
gE9F (2nd)
CACATGCAAGTCGAACGGATTATTC
TTCCGTTAAGAAGGATCTAATCTCC
GGCAGTATTAAAAGCAGCTCCAGG
AACGGATTATTCTTTATAGCTTGCT
[39]
Neorickettsia risticii ER3(1s)
ER2(1s)
ER3a (2nd)
ER2a (2nd)
ATTTGAGAGTTTGATCCTGG
GTTTTAAATGCAGTTCTTGG
CTAGCGGTAGGCTTAAC
CACACCTAACTTACGGG
[40]

Table 1: Primers and protocols used in the study of Ehrlichia spp., Anaplasma spp. and Neorickettsia risticii in birds and bats from the northern Brazilian pantanal.

All products obtained in the reactions were subjected to gel electrophoresis in horizontal 1.5% agarose gel stained with ethidium bromide (0.5 mL/ml - Invitrogen®) and 1X TBE running buffer pH 8.0 (44.58 M Tris-base, 0.44 M boric acid, 12.49 mM EDTA) to 110v/50mA with subsequent visualization under ultraviolet light (UV) in a darkroom. In order to prevent PCR contamination, DNA extraction, reaction set-up, PCR amplification and electrophoresis were performed in separate rooms. DNA of Sao Paulo strain of E. canis, A. platys from dog blood diagnosed with anaplasmosis and strain Illinois of N. risticii gently provide by Dr. S. Dumler was used as positive control in all reaction. Samples were collected under license granted by the Authorization System and Biodiversity Information - SISBIO number 33602-1.

Results and Discussion

One hundred and sixteen species of wild birds were captured and characterized [27-30]. Thirteen domestic fowl (Gallus gallus) were also evaluated, although there are no previous reports of Anaplasmatacea pathogens in this avian species. In addition, twenty-three blood samples from nectar-feeding bat Glossophaga soricina (Phyllostomidae) [31] were collected. All wild birds collected and their main features are shown in the Table 2.

Family Nomenclature Common name Feeding Character* N*
Columbidae Columbina picui Patagioenas cayennensis Rolinha-picui Pomba-galega Granivorous and Frugivorous
Granivorous and Frugivorous
Residents Residents 2
Corvidae Cyanocorax cyanomelas Gralha-do-Pantanal Omnivorous Residents 1
Cuculidae Coccyzus euleri Papa-lagarta-de-euler Insectivorous INTRA 1
Dendrocolaptidae Dendroplex picus Arapaçu-de-bico-branco Insectivorous Residents 4
Emberizidae Volatinia jacarina
Sporophila caerulescens
Sporophila angolensis
Tiziu (Esporofilo)
Coleirinho
Curió
Granivorous
Granivorous
Granivorous
INTRA
INTRA
INTRA
3
Furnariidae Furnarius rufus
Certhiaxis cinnamomeus
Cranioleuca vulpine
Synallaxis albilora
João-de-barro
Curutié
Arredio-do-rio
João-do-pantanal
Insectivorous
Insectivorous
Insectivorous
Omnivorous
Residents  
Residents
Residents  
Residents
14
Galbulidae Galbula ruficauda Ariramba-de-cauda-ruiva Insectivorous Residents 1
Icteridae Cacicus cela
Agelaioides badius
Xexéu (guaxo amarelo)
Asa-de-telha
Omnivorous
Frugivorous
Residents
Residents
4
Parulidae Basileuterus flaveolus Canário-do-mato Insectivorous Residents 2
Phasianidae Gallus gallus Galinha Omnivorous Residents 13
Picidae Veniliornis passerinus
Picumnus albosquamatus
Picapauzinho-anão
Pica-pau-anão-escamado
Insectivorous
Insectivorous
Residents
Residents
5
Pipridae Antilophia galeata
Neopelma pallescens
Soldadinho
Fruxu-do-cerradão
Frugivorous
Insectivorous
Residents
Residents
8
Polioptilidae Polioptila dumicola Balança-rabo-de-máscara Insectivorous Residents 2
Rhynchocyclidae Todirostrum cinereum
Herpsilochmus longirostris Poecilotriccus latirostris
Hemitriccus margaritaceiventer
Ferreirinho-relógio
Chorozinho-de-bico-comprido
Ferreirinho-de-cara-parda
Olho-de-ouro
Insectivorous
Insectivorous Insectivorous
Insectivorous
Residents
Residents Residents
Residents
12
Thamnophilidae Cercomacra melanaria
Thamnophilus pelzelni
Chororó-do-pantanal
Choca-do-planalto
Insectivorous
Insectivorous
Residents
Residents
7
Thraupidae Ramphocelus carbo
Saltator similis
Paroaria capitata Tachyphonus rufus
Lanio penicillatus
Pipira-vermelha
Trinca-ferro
Galo-da-campina-pantaneiro
Pipira-preta
Pipira-da-taoca
Omnivorous
Omnivorous
Omnivorous Omnivorous
Omnivorous
Residents
Residents
Residents Residents
Residents
21
Tityridae Tityra inquisitor Anhambé-de-boina Omnivorous Residents 1
Turdidae Turdus rufiventris Sabiá-laranjeira Omnivorous Residents 1
Tyrannidae Myiarchus tyrannulus Elaenia chilensis
Cnemotriccus fuscatus
Myiarchus ferox
Myiarchus swainsonii
Myiopagis viridicata
Maria-cavaleira-de-rabo-enferrujado
Guaracava-de-crista-branca
Guaracavuçu
Maria-cavaleira
Irré
Guaracava-de-crista-alaranjada
Omnivorous Omnivorous
Insectivorous
Omnivorous
Omnivorous
Omnivorous
INTRA INTRA
INTRA
INTRA
INTRA
INTRA
27
Phyllostomidae Glossophaga soricina Morcego-beija-flor Nectar-feeding - 23

Table 2: Birds and bats collected in Pantanal region and main features.

Wild birds may play a role as carriers of Anaplasmataceae agents in Brazil as previously described by Machado et al. [1], therefore the choice of collection points were intended to catch birds in different subtypes of the Pantanal and to cover the major habitat types in each region (data not shown), according to the applied model RAPELD PPBIO [32]. Despite the wide range of collections, in our study no PCR product was obtained from either Anaplasma spp., Ehrlichia spp. or N. risticii.

Machado et al. [1] reported the presence of DNA of A. phagocytophilum, E. chaffeensis and an Ehrlichia species closely related to E. canis in carnivorous avian blood samples, but ectoparasites were not found parasitizing birds. Furthermore, the positive birds had carnivorous habits while no other one avian family were detected with Anaplasmataceae DNA. These finding infer that the absence of detection of pathogens in our study may be related to the fact that the birds were not able to develop bacteremia or did not have carnivorous habits, probably because feeding habits of birds may imply in differences in the occurrence of infection, once the eating habits can influence the willingness of birds to certain pathogens and these habits can vary widely between birds depending on the region studied [33]. Johnston et al. [4] in an experimental study showed that the American robin (Turdus migratorius (L.)) are able to infect I. scapularis larval feeding ticks without developing bacteremia, specific antibodies or significant illness because of exposure.

Due to the fact of the samples were derived from cryopreserved blood banks, information on tick infestation could not be obtained. Studies regarding Anaplasmataceae agents infection in ticks collected from wild birds has been performed for a better understanding of the dynamics between birds and ticks and there is a concordance between the authors that the involvement of birds in the ecology and epidemiology of tick-borne diseases still unclear [34-37].

Bjoersdorff et al. [2] found a large number of migratory birds infested with Ehrlichia positive I. ricinus ticks and Ehrlichia 16S rRNA nucleotide sequences found in these ticks were identical to the HGE Ehrlichia found in humans in Sweden and Slovenia, what suggest that birds may play an important role in the dispersal of I. ricinus infected and may contribute to the distribution of granulocytic ehrlichiosis. Besides, none I. ricinus larvae infected were observed by Bjoersdorff et al. [2] which may suggest that migratory birds are incompetent reservoirs of Ehrlichia spp [38] and act just as long-distance carriers of infected ticks. Transovarial transmission of Ehrlichia and Anaplasma species [39] has not been demonstrated, so reservoir hosts are necessary to maintain the life cycle in the environment [5].

In the environment, N. risticii infects trematodes and adult forms may develop in the intestine of insectivorous vertebrates. Cicuttin et al. [16] related the first detection of N. risticii in internal organs of insectivorous bats (Brazilian free-tailed bat Tadarida brasiliensis) from Argentina and associated this species as reservoirs of these pathogens. G. soricina bats captured in the Pantanal region are known for nectar-feeding habits, thus this feature impairs contact with infected trematodes and this species may not act as wild reservoirs of N. risticii.

In view of the potential presence of N. risticii [40] especially in the Pantanal area, further studies involving bats species in this region should elucidate the potential involvement in the transmission of this agent in Brazil. Nevertheless a more detailed study should be analyzed as the presence of species of trematodes and snail in the Pantanal, since snails of the genera reported in the Pantanal have been found in properties with the occurrence of EME in other regions of Brazil [18,19].

Our results suggest that wild and domestic birds and bats from Pantanal region are unlikely to play a significant role in the maintenance of Anaplasmataceae agents and DNA survey from this species may not be a reliable indicator of exposure. More studies investigating the ecological factors and ticks burden in avian or bats hosts are needed to improve the understanding on the dynamics of Anaplasmataceae diseases in the relative area. Future efforts should include ticks identification in birds and bats from the Pantanal and experimental evaluations to understand the mechanisms that drives bird exposure risk and susceptibility to ticks and tick-borne diseases.

Acknowledgement

We thank to Rafael W. Wolf for technical support. This work was supported by Conselho Nacional de Desenvolvimento Científico e Tecnologico (CNPq research grant and scholarship to DMA), Ministerio da Educacao (MEC scholarships to LGFS), Coordenacao de Aperfeicoamento de Pessoal de Nível Superior (CAPES graduating scholarships to LPB and DGR), Fundacao de Amparo a Pesquisa do Estado de Sao Paulo (FAPESP graduating scholarships to TO and JA).

References

Select your language of interest to view the total content in your interested language
Post your comment

Share This Article

Relevant Topics

Article Usage

  • Total views: 12264
  • [From(publication date):
    October-2013 - Dec 19, 2018]
  • Breakdown by view type
  • HTML page views : 8467
  • PDF downloads : 3797
 

Post your comment

captcha   Reload  Can't read the image? click here to refresh

Peer Reviewed Journals
 
Make the best use of Scientific Research and information from our 700 + peer reviewed, Open Access Journals
International Conferences 2018-19
 
Meet Inspiring Speakers and Experts at our 3000+ Global Annual Meetings

Contact Us

Agri and Aquaculture Journals

Dr. Krish

[email protected]

+1-702-714-7001Extn: 9040

Biochemistry Journals

Datta A

[email protected]

1-702-714-7001Extn: 9037

Business & Management Journals

Ronald

[email protected]

1-702-714-7001Extn: 9042

Chemistry Journals

Gabriel Shaw

[email protected]

1-702-714-7001Extn: 9040

Clinical Journals

Datta A

[email protected]

1-702-714-7001Extn: 9037

Engineering Journals

James Franklin

[email protected]

1-702-714-7001Extn: 9042

Food & Nutrition Journals

Katie Wilson

[email protected]

1-702-714-7001Extn: 9042

General Science

Andrea Jason

[email protected]

1-702-714-7001Extn: 9043

Genetics & Molecular Biology Journals

Anna Melissa

[email protected]

1-702-714-7001Extn: 9006

Immunology & Microbiology Journals

David Gorantl

[email protected]

1-702-714-7001Extn: 9014

Materials Science Journals

Rachle Green

[email protected]

1-702-714-7001Extn: 9039

Nursing & Health Care Journals

Stephanie Skinner

[email protected]

1-702-714-7001Extn: 9039

Medical Journals

Nimmi Anna

[email protected]

1-702-714-7001Extn: 9038

Neuroscience & Psychology Journals

Nathan T

[email protected]

1-702-714-7001Extn: 9041

Pharmaceutical Sciences Journals

Ann Jose

[email protected]

1-702-714-7001Extn: 9007

Social & Political Science Journals

Steve Harry

streamtajm

[email protected]

1-702-714-7001Extn: 9042

 
© 2008- 2018 OMICS International - Open Access Publisher. Best viewed in Mozilla Firefox | Google Chrome | Above IE 7.0 version
Leave Your Message 24x7