Reach Us +44-1522-440391
Spectrum of and#946;-Globin Gene Mutations and and#946;-Thalassemia Haplotype Analysis among the Iranian Azeri Turkish Population | OMICS International
ISSN: 2161-1165
Epidemiology: Open Access

Like us on:

Make the best use of Scientific Research and information from our 700+ peer reviewed, Open Access Journals that operates with the help of 50,000+ Editorial Board Members and esteemed reviewers and 1000+ Scientific associations in Medical, Clinical, Pharmaceutical, Engineering, Technology and Management Fields.
Meet Inspiring Speakers and Experts at our 3000+ Global Conferenceseries Events with over 600+ Conferences, 1200+ Symposiums and 1200+ Workshops on Medical, Pharma, Engineering, Science, Technology and Business

Spectrum of β-Globin Gene Mutations and β-Thalassemia Haplotype Analysis among the Iranian Azeri Turkish Population

Sima Mansoori Derakhshan1,2, Aziz Khorrami2, Abbasali Hosseinpour Pour Feizi1 and Mahmoud Shekari Khaniani2*

1Hematology Oncology Research Center, Children's Hospital, Tabriz University of Medical Sciences, Tabriz, Iran

2Medical Genetic Department, Faculty of Medicine, Tabriz University of Medical Sciences, Tabriz, Iran

*Corresponding Author:
Mahmoud Shekari Khaniani
Department of Medical Genetics
Faculty of Medicine
Tabriz University of Medical Sciences
Tabriz, Iran
Tel: 984133371587
E-mail: [email protected]

Received date: September 02, 2015 Accepted date: December 18, 2015 Published date: December 26, 2015

Citation: Derakhshan SM, Khorrami A, Feizi AHP, Khaniani MS (2015) Spectrum of β-Globin Gene Mutations and β-Thalassemia HaplotypeAnalysis among the Iranian Azeri Turkish Population. Epidemiology (sunnyvale) 5:210. doi:10.4172/2161-1165.1000210

Copyright: © 2015 Derakhshan SM, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution and reproduction in any medium, provided the original author and source are credited.

Visit for more related articles at Epidemiology: Open Access


Background: A variety of mutations influencing gene transcription, translation, or mRNA processing have been identified in β-thalassemia. Several studies demonstrated a nonrandom linkage of particular RFLP haplotypes with specific β-thalassemia mutations. Linkage analysis using β-globin haplotypes is a valuable tool for indirect mutation detection. Our aim was to determine the spectrum and frequency of β-thalassemia mutations among Northwestern Iranians (Azeri Turkish population) along with determining the heterozygosity and polymorphism information content (PIC) value for seven β-globin markers. Method: We investigated spectrum of β-thalassemia mutations via ARMS-PCR technique followed by sequencing technique. Also β-globin gene cluster haplotypes was determined by PCR-RFLP technique on DNA samples of the patients and his (her) parents or siblings. Result: We detected 36 different mutations among 554 non-identical mutant chromosomes. The most frequent mutation was IVSII-1 (G>A) (23.6%), followed by IVSI-110 (G>A) (11.9%) and CD8 (-AA) (10.5%). Of the various β- globin gene cluster haplotypes, haplotypes I and IV were found to be most common among normal (21.36%) and mutant (15.76%) chromosomes, respectively. The highest observed heterozygosity (48%) was found for the HindIII Gγ and HindII 5'ψß polymorphic sites, whereas the highest expected heterozygosity (50%) was predicted for the HindIII Gγ and HindII sites, which also had the highest PIC value of 0.37. Conclusion: The current study implies mutational heterogeneity among investigated population. Haplotype study results (heterozygosity and PIC), clarifies β-globin markers usefulness for tracking mutant alleles as a complementary method to confirm the genotype in prenatal diagnosis (PND) among investigated population.


β-thalassemia; Haplotypes; DNA polymorphism; Prenatal diagnosis


β-Thalassemia, an inherited hemoglobin disorder, is characterized by the reduction or absence of β -globin chain synthesis [1]. Inheritance of a single defective gene in carriers causes microcytosis and mild anemia, while two β-globin gene mutations, one inherited from each parent, results in the clinically severe disease thalassemia major, also known as Cooley’s anemia [2]. The severe form necessitates life-long blood transfusions and other medical support along with iron-chelating agents for the treatment of iron overload [3]. The treatment is expensive, requiring huge payments by the available health care resources. The detection of ß-thalassemia mutation, genetic counseling, and prenatal diagnosis (PND) programs can pave the way for the prevention of the disease and ease this health burden [4,5].

β-thalassemia is the most frequent single gene disorder in Iran, with about 25,000 β -thalassemia major patients and more than two million carriers living in the country [6,7]. The prevalence of β-thalassemia is highest in the Northern and Southern provinces, with an approximate rate of 10% [8,9]. Pre-marriage and PND programs for the prevention of ß-thalassemia have been implemented in Iran since 1997 [10]. The Ministry of Health oversees the hemoglobinopathy control program.

At the present, more than 400 mutations in the ß-globin gene have been characterized all over the world [11]. β-globin gene mutations show allelic heterogeneity at the molecular level, with varied distribution among different ethnic groups and geographical locations [12-14].

When the direct method for the detection of mutations is unsuccessful, haplotype analysis is often helpful in the identification of a βthal chromosome, with accuracy as high as 90% in informative families [15,16]. Previous studies suggest that the association between mutations and restriction fragment length polymorphism (RFLP) haplotypes is not random, and that each haplotype is usually associated with one specific type of mutation [17]. RFLP analysis of the β-globin gene cluster and haplotype determination can prove advantageous for determining the origin and spread of ß-thalassemia and for defining the relationships between several human populations [17]. Given that the population of Iran includes various ethnic groups including Persian (51%), Azeri Turk (24%; approximately 15-20 million members reside in the northwestern part of Iran), Kurd (7%), Arab (3%) [18], and other minorities such as Armenians, the frequency of mutations and related haplotypes in hemoglobinopathies should be studied separately for each region or population. Accurate data on β-thalassemia mutations in a specific population offers valuable information for β-thalassemia prevention programs through heterozygote screening and PND [19,20].

In this study, we investigate the mutation spectrum and haplotype/mutation association among the Azeri Turkish population. We also describe the use of the ß-globin gene cluster haplotypes for prenatal diagnosis of β-thalassemia mutations in 45 pregnancies at risk for carrying fetuses homozygous for β-thalassemia.

Materials and Methods


One-thousand-two-hundred potential at-risk couples at the premarital or PND stages were referred to our center between 2011 and June 2014 by three health province centers (East Azerbaijan, West Azerbaijan, and Ardabil centers) based on hematological indices (MCV<80 fl, MCH<27 pg). Four hundred sixty eight couples with at least one partner with MCV<80 fl, MCH<27 pg, and HbA2>3.5% were considered potential carrier couples for β-thalassemia [21], and subjected to genetic studies for the detection of β-thalassemia mutations.

This study was approved by the Ethics Committee of Tabriz University of Medical Sciences. Written Informed consent was obtained from all the participants.

Haplotype analysis has been performed only for 122 couples (57 Unrelated and 65 consanguineous couples) who both were carrier of β-thalassemia.

We determined the β-haplotypes by family linkage study using PCR and restriction enzyme digestions. Haplotype analysis has been limited in 1330 chromosomes, including βthal carriers and their healthy non-carrier related family members. All participants were from Azeri Turkish background, residing in northwest of Iran.

Detection of mutations

ARMS-PCR technique was used for the detection of ß-thalassemia mutations, as described [22,23]. Seven mutations in the ß-globin gene, including IVSII-1 (G>A), IVSI-1 (G>T/A), CD 8/9 (+G), CD 8 (-AA), IVSI-5 (G>C), IVSI-110 (G>A), and IVSI-6 (T>C), were screened. When the mutation was not detectable by the ARMS-PCR method, the whole ß-globin gene was analyzed by sequencing of two PCR-amplified DNA fragments. The following primer pairs were used for the amplification of the 766 and 578 bp fragments, respectively: FA-Fwd (5’-CTGAGGGTTTGAAAGTCCAACTCC-3’) and FA-Rev(5’-GTGAAGCATCTCCTGGACTCA-3’);FBFwd(5’ATGTATCATGCCTCTTTGCACC3’)andFBRev(5’GCACTGACCTCCCACATTCC-3’) [24].

Haplotype analysis

Haplotype analysis has been carried out by PCR-RFLP on DNA samples of the carrier individual and his (her) parents or siblings in the form of family tree. Haplotypes were numbered according to Orkin et al. [25]. Seven restriction endonuclease sites within the β-globin gene cluster (5’ - HindII 5’ε, HindIII Gγ, HindIII Aγ, HindII 5’ψβ, HindII 3’ψβ, AvaII β, and HinfI β-3’) were used for haplotype construction [23,25].

Statistical analyses

Comparison of haplotype frequencies between wild-type and mutant chromosomes was carried out using either chi-square or Fisher’s exact test, as appropriate. Probability values of 0.05 or less were considered as statistically significant. The expected heterozygosities were calculated according to the Hardy-Weinberg equation. χ2 tests were used to inspect differences between observed and expected heterozygote frequencies. PIC was calculated according to Botstein et al. [26].


Characterization of mutations

Six couples out of 468 potential b-thalassemia carriers were excluded from further study as no mutations were found in b-globin gene. In 260 out of 462 investigated families, only one of the partners was carrier of β-thalassemia while in 202 couples, both partners were found to be carriers of β-thalassemia. As 110 out of these 202 couples were consanguineous, totally 554 non-identical mutant chromosomes were identified.

The most prevalent mutation was IVSII-1 (G>A) with a frequency of 23.6%, followed by IVSI-110 (G>A) with a frequency of 11.9%, while CD8 (-AA) with 10.5% frequency, comprised the third common mutation among the 554 non-identical βthal examined chromosomes. Other mutations and their observed frequencies included CD8/9 (+G) at 7.6%, IVSI-1(G>A) at 7.4%, IVSI-6 (T>C) at 6.3%, IVSI-5 (G>C) at 5.2%, CD39(C>T) at 3.1%, both CD5 (-CT) and (-30) TATA box at 2.7% each and CD44 (-CT) at 2.3% (Table 1).

  Mutation Name βthal Chromosome number Percentage% Number Related Haplotype/s
1 IVSII-I(G>A) 131 23.6 48 A(4), I(3), II(4), VII(9), IV(26), IX(2)
2 IVSI-110(G>A) 66 11.9 23 A(3), VIII(6), V(3), I(8), II(3)
3 CD8(-AA) 58 10.5 23 IX(5), X(2), III(9), V(3), I(4)
4 CD 8/9(+G) 42 7.6 10 III(1), II(4), I(5)
5 IVSI-I (G>A) 41 7.4 11 III Atypic(3), I(2), VII(2), A3(1), VIII(2)
6 IVSI-6 (T>C) 35 6.3 10 A3(2), I Atypic (8)
7 IVSI-5 (G>C) 29 5.2 10 V(11)
8 CD39 (C>T) 17 3.1 11 A3(2), A(2), VII(2), I(1)
9 CD5(-CT) 15 2.7 7 A3(1), I Atypic(2), VII(1), IX(2)
10 (-30) TATA Box 15 2.7 6 (---++-+)(2), VI(1), V(1)
11 CD44(-CT) 13 2.3 4 A(1), VII(1), V(2)
12 CD36/37(-T) 10 1.8 4 VI(1)
13 CD15TGG>TGA 9 1.6 2 A3(3)
14 Sicillian 8 1.4 1 IX(1)
15 IVSI 3end25 del 7 1.3 1 I(1), I Atyipic(1)
16 IVSII-745 (C>G) 6 1.1 1 (++--+-+) (1)
17 CD22/23/24-7 bp (-AAGTTGG) 6 1.1 3  
18 (-28) TATA Box 5 0.9 1  
19 IVSI-128 (T>G) 5 0.9 165  
20 -87C>A 4 0.7    
21 CAP+20 (G>A) 4 0.7   A3(1)
22 CD82/83 (-G) 4 0.7    
23 CD29 (GGC>GGT) 3 0.7    
24 CD30(T30R) (G>C) 4 0.5   A3(3)
25 CAP+22 (G>A) 2 0.4   (++--+-+) (1)
26 IVSII-848 (G>A) 2 0.4    
27 1VSI-130 (G>C) 2 0.4   III Atypic(3), I(2), VII(2), A3(1), VIII(2)
28 (-86) C>G /N 2 0.4   A3(2), I Atypic (8)
29 CD16(-C) 2 0.4   V(11)
30 CD41/42 (-CTTT) 1 0.2   A3(2), A(2), VII(2), I(1)
31 c.*+96T>C 1 0.2   A3(1), I Atypic(2), VII(1), IX(2)
32 TER CD +74 A>G 1 0.2   (---++-+)(2), VI(1), V(1)
33 TER CD+93 (A>G) 1 0.2   A(1), VII(1), V(2)
34 (-90) (C>T) 1 0.2    
35 CD 25/26 (+T) 1 0.2    
36 (-101) C>T 1 0.2    
  Total 554 100%    

Table 1: Characterization of mutations.

The following mutations were observed at frequency below 2%: CD36/37(-T), CD15 (TGG>TGA), Sicilian, IVSI 3’ end25 end, IVSII-745(C>G), CD22/23/24-7 bp(-AAGTTGG), (-28) TATA Box, IVSI-128 (T>G), -87C>A, CAP+20 (G>A), CD82/83 (-G), CD30 (T30R) (G>C), CD29 (GGC>GGT), CAP+22 (G>A), IVSII-848 (G>A), 1VSI-130 (G>C), -86 (C>G), CD16(-C), CD41/42 (-CTTT), c.*+96T>C, TER CD +74 A>G, TER CD+93 (A>G), (-90) C>T, CD 25/26 (+T), (-101) C>T (Table 1).

Haplotype study

With considering heterozygosity, informativity and linkage phase of studied markers in investigated pedigrees, the haplotype could be unequivocally established in 515 normal and 165 mutant chromosomes. The results of the β-globin gene cluster haplotype analysis for the βA chromosomes are shown in Figure 1. Haplotypes I, V, IX, VII, II, and A together account for 68.9% of the βA chromosome haplotypes, with their individual frequencies being 21.36%, 11.65%, 10.68%, 11.6%, 6.8%, 6.8%, respectively (Figure 1). The following haplotypes were observed in low frequency in βA chromosomes:


Figure 1: Haplotype study.

D, IV, III, VIII, A3, III atypic, VI, X, (---+-++), (-+--++-), (---++-+), (++--+-+), (-++-++-), (+-----+) and (-++---+) (Figure 1).

A total of 16 haplotypes were found to be associated with the βthal chromosomes (Figure 1). The most frequent β-globin gene cluster haplotypes observed among the βthal chromosomes were IV, I and V with frequencies of 15.76%, 14.55%, 12.1%. Haplotype VII was observed with frequency of 9.1%. The observed frequency of haplotypes, II, III, I Atypic, IX, A3 and A was around 6% in each. Haplotype VIII showed frequency of 4.8%. The frequency of other identified haplotypes were less than 2% (Figure 1).

The following β-thalassemia mutations were included in the haplotype study: IVSII-1 (G>A) (48 chromosomes), IVSI-110 (G>A) and CD8 (-AA) (23 chromosomes each), IVSI-5(G>C) (10 chromosomes), IVI-I, CD8/9 (+G) and IVSI-6 (T>C) (10 chromosomes each), CD39(C>T) (7 chromosomes), CD5(-CT) (6 chromosomes), CD44(-CT) and (-30) TATA Box (5 chromosomes each), CD15(TGG>TGA) (3 chromosomes), IVSI-3’end25del (2 chromosomes) and Sicilian, CD36/37(-T), CAP+22 (G>A), IVSII-745(C>G) (1 chromosome each) (Table 1).

The allele frequencies of all the markers are shown in Table 2, with (+) and (-) denoting digestible and indigestible alleles, respectively.

Marker Allele Chromosomes Frequency H(Obs.) H (Exp.) PICa P value
HindII e + 640/1330 0.48 0.44 0.5 0.37 0.856
- 690/1330 0.52
HindIII Gg + 630/1330 0.47 0.48 0.5 0.37 0.95
- 700/1330 0.53
HindIII Ag + 245/1330 0.18 0.3 0.3 0.26 1
- 1085/1330 0.82
HindII 5'yβ + 430/1330 0.32 0.47 0.44 0.33 0.9
- 900/1330 0.68
HindII 3'yβ + 490/1330 0.37 0.45 0.48 0.34 0.91
- 840/1330 0.63
HinfIβ + 835/1330 0.63 0.34 0.46 0.34 0.14
- 495/1330 0.37
AvaIIβ + 935/1330 0.7 0.4 0.42 0.32 0.94
- 395/1330 0.3

Table 2: The allele frequencies of all the markers.

The highest heterozygosity was observed for HindIII Gγand HindII 5'Ψβ polymorphic markers with a value of 48%, while the other markers HindII 3'ψβ, HindII ε, AvaII β, HinfI β3’, and HindIII Aγshowed lower heterozygosity values of 0.45%, 0.44%, 0.40%, 0.34%, and 0.30%, respectively. The expected heterozygosity did not exhibit a similar trend, as shown in Table 2; however, the differences between observed and expected heterozygosity rates for all the seven markers were found to be statistically insignificant.

Overall, the gene frequencies of each marker revealed the population to be in Hardy-Weinberg equilibrium.

However, the PIC value of the HindIII Gγand HindII εmarkers (0.37) was the highest among the seven polymorphic sites, while the markers HindII 3'Ψβ and HinfI β had PIC values of 0.34, and the HindII 5'Ψβ, AvaII β, and HindIII Aγmarkers had lower PIC values of 0.33, 0.32, and 0.26, respectively. We also successfully applied RFLP linkage analysis for 45 out of 53 PND cases of β-thalassemia (Figure 2).


Figure 2: The allele frequencies of all the markers.


The purpose of this study was to obtain data on the prevalence of β-thalassemia mutations and to compare the haplotypes associated with ßthal and ßA chromosomes in northwestern Iran. Iran is a multi-ethnic country, and each region of the country has its own distinct set of β-globin mutations. To our knowledge, there isn’t any previous study associating particular β-globin gene cluster haplotypes and mutations in northwestern Iran with the Azeri Turkish population. Although more than 400 β-thalassemia alleles have been characterized worldwide [11], few mutations are common among any given population in the areas in which β-thalassemia is prevalent [27]. Population studies demonstrate that 40 mutations account for 90% or more of the β-thalassemia mutations worldwide [27]. In the countries of the Middle East, IVSI-5 (G>C), IVSI-110 (G>A), IVSI-1(G>A), codon 39 (C>T), IVSI-6 (T>C), IVSII-1 (G>A), and codon 5 (-CT) together account for>90% of the β-thalassemia mutations [28]. Previous studies in Iran, which has a multi-ethnic population, indicate that each province has its distinctive mutation spectrum, with IVSII-1 (G>A), IVSI-5 (G>C), CD8/9 (+G), and IVSI-110 (G>A) constituting the most prevalent mutations [5,29].

In the current study, a total of 554 non-identical mutant chromosomes were examined, among which 36 different mutations were observed. The most frequently observed mutation was IVSII-1 (G>A) (23.6%), followed by IVSI-110 (G>A) (11.9%). The IVSII-1 (G>A) mutation, known as the Mediterranean type, has been previously reported as the most frequently occurring mutation in most of the Arab countries [30], as well as in the Kurdestan and fars provinces of Iran, which are located west and south, respectively [31,32,33]. The seven most common mutations, which include IVSII-1 (G>A), IVSI-110 (G>A), CD8 (-AA), CD8/9 (+G), IVSI-I, IVSI-6 (T>C), and IVSI-5 (G>C), together accounted for 72.6% of the mutant alleles.

Orkin et al. have shown that there is strong linkage disequilibrium between the β-globin gene cluster haplotypes and β-thalassemia mutations within regional populations. However, a high level of heterogeneity likely exists in these associations both within and between populations [34-36].

An investigation of the association of specific mutations with different haplotypes showed that IVSII-1 (G>A), the most common mutation, was associated with six different haplotypes, with haplotype IV being predominant (54%). This haplotype was not associated with other mutations. Haplotype VII was the second most common haplotype linked with the IVSII-1 (G>A) mutation. In contrast, previous studies show that the IVSII-1 (G>A) mutation was associated with haplotypes III and V in the Turkish population [35] and with haplotypes I and III, respectively, in the Palestinian [37] and Lebanese [38] populations.

Of the 23 mutant chromosomes with IVSI-110 (G>A) that were analyzed, eight Mediterranean haplotype I chromosomes were found. In addition, haplotypes VIII (6 chromosomes), II (3 chromosomes), V and A (3 chromosomes each) were the other haplotypes associated with the IVSI-110 (G>A) mutation in our study. The association of the IVSI-110 (G>A) mutation with haplotypes I, II, IV, VII, and IX have been reported in world populations [35-39].

The CD8 (-AA) mutation was first identified in Turkish patients and subsequently detected in the Middle East region, and is reported to occur at very low frequencies among the Mediterranean populations [40,13]. In the current study, the association of the CD8 (-AA) mutant chromosomes with haplotypes I, III, V, X and IX was revealed. This mutation has been previously reported to show linkage with haplotypes IV in Moroccan population [40], IX in Algerian [13], and IV and VII in Turkish populations [35].

The IVSI-5 (G>C) mutation has been reported to be linked with haplotypes I and V in Brazilian β-thalassemia patients [41]. In association India, on the other hand, the IVSI-5 (G>C) is the most common mutation, and showed with eight different haplotypes, haplotype V being predominant (54%) [42]. Assessment of haplotypes linked with the IVSI-5 (G>C) mutation in the current study revealed association only with haplotype V.

The prevalence of the haplotypes varied among patients from different geographical areas. For instance, among Mediterranean patients, haplotype I was found to be the most prevalent haplotype (47%) associated with βthal chromosomes, followed by haplotypes II (17%) and V (12%) [34]. Among the Corsican population, strong association between CD39 (C>T) as the most common mutation (88.40%) with haplotype II was revealed [43]. CD39 (C>T) and the IVS-I-110 (G>A) mutations as two most frequent mutations in Northern Ireland exclusively linked with haplotype I [44].

Haplotype I was also found to be the most prevalent haplotype among β-thalassemia patients and healthy individuals (35.7% and 43.3%, respectively) in the western region of Iran (with Kurdish ethnic population) [31,45], as also among the β-thalassemia minor individuals or normal controls (46.2% and 43.3%, respectively) from Southern Iran [15]. However, the second most prevalent haplotypes for β-thalassemia patients and controls were haplotypes III (28.6%) and V (14.3%), respectively, in western Iran, and haplotypes V (15.4%) and III (15.4%), respectively, in southern Iran [15,31,45]. The current study revealed that haplotypes I (27.1%) and IV (18.1%) were the most prevalent haplotypes among βA and βthal chromosomes, respectively. The second most prevalent haplotype included haplotype I among βthal chromosomes (15.1%) and haplotype V (10.67%) among βA chromosomes. These differences in haplotype frequencies could be attributable to the diversity in ethnic backgrounds that exist in different regions of Iran.

In the current study, haplotype IV was found to be specifically associated with the most common mutation, IVSII-I, with a frequency of 54.1%; therefore, it can be concluded that the high frequency of the IVSII-I mutation resulted in the high prevalence of haplotype IV in our study. On the other hand, a comparison of the frequencies of different haplotypes associated with βthal and βA chromosomes did not reveal any significant differences, with the exception of haplotype IV, which was significantly higher in β thal chromosomes (p value<0.05; Figure 1).

Four of the 5’ haplotypes (5’ - HindII 5’ε, HindIII Gγ, HindIII Aγ, HindII 5’ψβ, HindII 3’ψβ, -3’) accounted for 86% and 81.8% of the βA and βthal chromosomes, respectively. The frequencies of these haplotypes, namely (+----), (-+-++), (-----), and (-++-+), were 45.6%, 18.4%, 11%, and 11% for βA chromosomes, and 35%, 27.8%, 6%, and 13% for βthal chromosomes. Haplotype (+----) was the most frequent 5’ haplotype among the Azeri Turkish population, followed by the haplotype (-+-++).

Among Mexican population, two of three most frequent mutations, the CD39 (C>T) and IVS-I-1 mutations, were observed with five 5' haplotypes with haplotypeIng the most prevalent. Whereas the IVS-I-110 was only found in association with haplotype I [46].

PND helps prevent the birth of offsprings with thalassemia among high-risk couples (with both partners being carriers), and can be performed in the first trimester of pregnancy by direct and indirect analyses of DNA extracted from amniocytes and CVS. Haplotype analysis can be used for the verification of the direct method or independently as an indirect method, and is also helpful to rule out the possibility of fetal sample contamination with maternal blood or tissue. In the current study, haplotype analysis proved useful for diagnosis in 45 out of 53 at-risk couples under investigation.


The identification of 36 different mutations implies high rates of mutational heterogeneity, and offers useful information about the types and geographic or ethnic distribution of β-thalassemia mutations in northwest Iran, thereby allowing rapid detection of mutations.

In addition, the occurrence of 16 different haplotypes on βthal chromosomes and the recognition of dissimilar haplotypes as most prevalent on βthal and βA chromosomes provide evidence that β-thalassemia mutations might have originated as a result of gene flow due to population migration along with new mutation events in a common chromosomal background in the population.

Our results show that (+----), (-+-++), (-----), and (-++-+) are the dominant 5’ haplotypes, together accounting for 86% and 81.8% of the βA and βthal chromosomes, respectively.

Among the investigated polymorphic sites, the highest heterozygosity of 48% was observed for the HindIII Gγand HindII 5'Ψβ markers, whereas the highest heterozygosity of 50% was expected for HindIII Gγand HindII εmarkers, which have the highest PIC value of 0.37. The current study presents the levels of informativity of the seven RFLP markers investigated in the β-globin locus, and show that haplotype analysis using these polymorphic markers can prove useful for carrier detection, particularly in cases where unknown mutations are encountered and confirming PND reliability in the target population.


This paper was funded by Hematology Oncology Research Center, Tabriz University of Medical Sciences, Tabriz, Iran.


Select your language of interest to view the total content in your interested language
Post your comment

Share This Article

Relevant Topics

Article Usage

  • Total views: 8962
  • [From(publication date):
    December-2015 - Jan 28, 2020]
  • Breakdown by view type
  • HTML page views : 8806
  • PDF downloads : 156